Risk factors associated with indoor transmission during home quarantine of COVID-19 patients.

Purpose: The study aimed to identify potential risk factors for family transmission and to provide precautionary guidelines for the general public during novel Coronavirus disease 2019 (COVID-19) waves. Methods: A retrospective cohort study with numerous COVID-19 patients recruited was conducted in Shanghai. Epidemiological data including transmission details, demographics, vaccination status, symptoms, comorbidities, antigen test, living environment, residential ventilation, disinfection and medical treatment of each participant were collected and risk factors for family transmission were determined. Results: A total of 2,334 COVID-19 patients participated. Compared with non-cohabitation infected patients, cohabitated ones were younger (p = 0.019), more commonly unvaccinated (p = 0.048) or exposed to infections (p < 0.001), and had higher rates of symptoms (p = 0.003) or shared living room (p < 0.001). Risk factors analysis showed that the 2019-nCov antigen positive (OR = 1.86, 95%CI 1.40-2.48, p < 0.001), symptoms development (OR = 1.86, 95%CI 1.34-2.58, p < 0.001), direct contact exposure (OR = 1.47, 95%CI 1.09-1.96, p = 0.010) were independent risk factors for the cohabitant transmission of COVID-19, and a separate room with a separate toilet could reduce the risk of family transmission (OR = 0.62, 95%CI 0.41-0.92, p = 0.018). Conclusion: Patients showing negative 2019-nCov antigen tests, being asymptomatic, living in a separate room with a separate toilet, or actively avoiding direct contact with cohabitants were at low risk of family transmission, and the study recommended that avoiding direct contact and residential disinfection could reduce the risk of all cohabitants within the same house being infected with COVID-19.

Commemoration and Emotional Sustenance: A Text Analysis of Students' Motivations Behind Online Mourning of Dr Li Wenliang.

As one of the first doctors issued a protective warning to the public, Dr. Li Wenliang was known as "whistleblower" of COVID-19 pandemic. After his death of COVID-19, students entered to his Sina Weibo to display their condolences and sorrow. We conduct text analysis and sentiment classification to investigate the motivation behind online mourning for Dr. Li among students on Sina Weibo. Our results indicate that, a) there always more than one motivation behind online mourning exists in each time period. b) continuing connection and semi-interaction with the deceased is the main motivation when students mourn online. c) there exists positive correlation between the influence of the deceased and the motivation--sharing information with the community of fans and creating social support in a time of loss and social support. d) the motivation--honoring the dead and expressing sadness and resentment can gradually lose over time.

Gut microbiome alterations in patients with COVID-19-related coagulopathy.

COVID-19 is characterized by a predominantly prothrombotic state, which underlies severe disease and poor outcomes. Imbalances of the gut microbiome have been linked with abnormal hemostatic processes. Understanding the relationship between the gut microbiome and abnormal coagulation parameters in COVID-19 could provide a novel framework for the diagnosis and management of COVID-related coagulopathies (CRC). This cross-sectional study used shotgun metagenomic sequencing to examine the gut microbiota of patients with CRC (n = 66) and compared it to COVID control (CCs) (n = 27) and non-COVID control (NCs) (n = 22) groups. Three, 1, and 3 taxa were found enriched in CRCs, CCs, and NCs. Next, random forest models using 7 microbial biomarkers and differential clinical characteristics were constructed and achieved strong diagnostic potential in distinguishing CRC. Specifically, the most promising biomarker species for CRC were Streptococcus thermophilus, Enterococcus faecium, and Citrobacter portucalensis. Conversely, Enterobacteriaceae family and Fusicatenibacter genus are potentially protective against CRC in COVID patients. We further identified 4 species contributing to 20 MetaCyc pathways that were differentially abundant among groups, with S. thermophilus as the main coding species in CRCs. Our findings suggest that the alterations of gut microbiota compositional and functional profiles may influence the pathogenesis of CRC and that microbiota-based diagnosis and treatment could potentially benefit COVID patients in preventing and alleviating thrombosis-related clinical outcomes.

Municipal solid waste, an overlooked route of transmission for the severe acute respiratory syndrome coronavirus 2: a review.

Municipal solid waste could potentially transmit human pathogens during the collection, transport, handling, and disposal of waste. Workers and residents living in the vicinity of municipal solid waste collection or disposal sites are particularly susceptible, especially unprotected workers and waste pickers. Recent evidence suggests that municipal solid waste-mediated transmission can spread the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to humans. Such risks, however, have received little attention from public health authorities so far and may present an under-investigated transmission route for SARS-CoV-2 and other infectious agents during pandemics. In this review, we provide a retrospective analysis of the challenges, practices, and policies on municipal solid waste management during the current pandemic, and scrutinize the recent case reports on the municipal solid waste-mediated transmission of the coronavirus disease 2019 (COVID-19). We found abrupt changes in quantity and composition of municipal solid wastes during the COVID-19. We detail pathways of exposure to SARS-CoV-2 and other pathogens carried on municipal solid wastes. We disclose evidence of pathogenic transmission by municipal solid waste to humans and animals. Assessments of current policies, gaps, and voluntary actions taken on municipal solid waste handling and disposal in the current pandemic are presented. We propose risk mitigation strategies and research priorities to alleviate the risk for humans and vectors exposed to municipal solid wastes.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Cost analysis of severe burn victims in Southwest China: A 7-year retrospective study.

Background: Severe burn injury can be a life-threatening experience and can also lead to financial issues for suffers. The purpose of the current study was to analyze the direct hospitalization costs of severe burn inpatients in Southwest China. Methods: Data related to all inpatients admitted with severe burns [total body surface area (TBSA) ≥30%] pooled from 2015 to 2021 were reviewed retrospectively at the Institute of Burn Research of Army Medical University. Demographic parameters, medical economics, and clinical data were obtained from medical records. Results: A total of 668 cases were identified. The average age was 37.49 ± 21.00 years, and 72.3% were men. The average TBSA was 51.35 ± 19.49%. The median length of stay of inpatients in the burn intensive care unit was 14 [interquartile range (IQR): 5.0-34.8] days, and the median length of stay (LOS) was 41 (IQR: 22.0-73.8) days. The mortality rate was 1.6%. The median total cost was 212,755.45 CNY (IQR: 83,908.80-551,621.57 CNY) per patient varying from 3,521.30 to 4,822,357.19 CNY. The direct cost of scald burns was dramatically lower compared with that of other types of burns, with 11,213.43 to 2,819,019.14 CNY. Medical consumables presented the largest portion of total costs, with a median cost of 65,942.64 CNY (IQR: 18,771.86-171,197.97 CNY). The crucial risk factors for medical cost in our study were TBSA, surgical frequency, LOS, depth of burn, and outcome. Conclusion: We conclude that an effective burn prevention program, shorter hospital stays, and facilitating the healing of wounds should be focused on with tailored precautionary protocols to reduce the medical costs of inpatients with severe burns.

Challenges of online learning amid the COVID-19: College students' perspective.

Universities in China's transition to online education in response to the COVID-19 pandemic have spawned several research studies. However, studies exploring college students' technological skills, relationships with their peers and instructors, and collaborative learning experiences during the pandemic are scarce. Three aspects were explored in this mixed study: (1) changes in students' engagement in class and the main factors involved; (2) students' feelings and reactions during online learning; and (3) how students related to their peers and instructors. Data were collected through a qualitative survey supplemented by quantitative data about students' attitudes to online learning using the SAROL scale. This paper argues that online learning may not produce the desired results due to lack of interaction with instructors, no campus socialization or well-trained technology skills, and appropriate content for online courses and group work. The findings further revealed that online learning offers college students new ways to learn independently, collaborate and build relationships with their peers. It encourages them to reconsider ways to improve their technology skills, learning methods, communication skills and reconceptualize their responsibilities as team members.

The relationship between oxygen therapy, drug therapy, and COVID-19 mortality.

Since December, 2019, Wuhan, China, has experienced an outbreak of coronavirus disease 2019 (COVID-19). We conducted a retrospective study of COVID-19 inpatients in Wuhan Pulmonary Hospital (Wuhan, China) from January 1 to February 29, 2020. The subjects were divided into four groups due to different treatment regimes. We used the Kaplan-Meier method to determine the cumulative rates of in-hospital death and the Cox proportional hazard model to calculate the risk factors and corresponding hazard ratios. A total of 185 patients were included in this study. The median age of the patients was 62 years, including 94 men and 91 women. Kaplan-Meier analysis demonstrated that mortality was higher in older patients, higher in men, and lower in the low-flow oxygen therapy group. Body mass index (BMI) had no influence on mortality, as well as high flow oxygen therapy, Lopinavir-ritonavir (LPV/r) therapy, and the interferon-alpha add LPV/r therapy. Cox proportional hazard regression confirmed that the low flow oxygen therapy was independent protective factor for in-hospital death after adjusting for age, gender, and BMI. In conclusion, the mortality was higher in older patients, higher in men, and lower in the low-flow oxygen therapy group. BMI had no influence on mortality, as well as high flow oxygen therapy, LPV/r therapy, and interferon-alpha add LPV/r therapy.

A new class of quaternary ammonium compounds as potent and environmental friendly disinfectants.

Quaternary ammonium compounds (QACs) are inexpensive and readily available disinfectants, and have been widely used, especially since the COVID-19 outbreak. The toxicity of QACs to humans has raised increasing concerns in recent years. Here, a new type of QACs was synthesized by replacing the alkyl chain with zinc phthalocyanine (ZnPc), which consists of a large aromatic ring and is hydrophobic in nature, similar to the alkyl chain of QACs. Three ZnPc-containing disinfectants were synthesized and fully characterized. These compounds showed 15-16 fold higher antimicrobial effect against Gram-negative bacteria than the well-known QACs with half-maximal inhibitory (IC50) values of 1.43 µM, 2.70 µM, and 1.31 µM, respectively. With the assistance of 680 nm light, compounds 4 and 6 had much higher bactericidal toxicities at nanomolar concentrations. Compound 6 had a bactericidal efficacy of close to 6 logs (99.9999% kill rate) at 1 µM to Gram-positive bacteria, including MRSA, under light illumination. Besides, these compounds were safe for mammalian cells. In a mouse model, compound 6 was effective in healing wound infection. Importantly, compound 6 was easily degraded at working concentrations under sunlight illumination, and is environmentally friendly. Thus, compound 6 is a novel and promising disinfectant.

HOW TRANSFORMATIONAL LEADERSHIP CONTRIBUTES TO PERCEIVED SERVICE QUALITY BY CUSTOMERS VIA THE MEDIATING EFFECT OF ORGANIZATIONAL INNOVATION WITHIN TAIWAN TELECOMMUNCATION COMPANIES

[...]of this study, no correlation was found between age and service quality perceived by customers. According to research, transformational leaders could make a positive influence on perceived efficiency of information and communication companies by emphasizing the importance of effective use of information technology (Yee, 2000;Seyal, 2015). According to the main context of this forum, Taiwan's telecom business in 2020 was: the spread of COVID 19 virus and the trade war between America and China caused an 8 % drop in the global output value of communication equipment (Market Intelligence & Consulting Institute, 2021). In today's competitive and globalized market, telecommunication companies will emphasize that E -Service Management will have to offer better services to their customers because of improving the process and utilization of the service. [...]the E - service quality would have gradually become a core competency for all service industries (Jia & Reich, 2011;Hoerbst et al., 2011).

Municipal solid waste, an overlooked route of transmission for the severe acute respiratory syndrome coronavirus 2: a review

Municipal solid waste could potentially transmit human pathogens during the collection, transport, handling, and disposal of waste. Workers and residents living in the vicinity of municipal solid waste collection or disposal sites are particularly susceptible, especially unprotected workers and waste pickers. Recent evidence suggests that municipal solid waste-mediated transmission can spread the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to humans. Such risks, however, have received little attention from public health authorities so far and may present an under-investigated transmission route for SARS-CoV-2 and other infectious agents during pandemics. In this review, we provide a retrospective analysis of the challenges, practices, and policies on municipal solid waste management during the current pandemic, and scrutinize the recent case reports on the municipal solid waste-mediated transmission of the coronavirus disease 2019 (COVID-19). We found abrupt changes in quantity and composition of municipal solid wastes during the COVID-19. We detail pathways of exposure to SARS-CoV-2 and other pathogens carried on municipal solid wastes. We disclose evidence of pathogenic transmission by municipal solid waste to humans and animals. Assessments of current policies, gaps, and voluntary actions taken on municipal solid waste handling and disposal in the current pandemic are presented. We propose risk mitigation strategies and research priorities to alleviate the risk for humans and vectors exposed to municipal solid wastes.

Risk perception and mental health among college students in China during the COVID-19 pandemic: A moderated mediation model

Since the outbreak of the COVID-19 epidemic, it has spread on a large scale around the world, seriously affecting people’s physical and mental health. In China, almost all schools have postponed semesters, suspended offline classes, and implemented closed-off management, which has brought significant challenges to the study and life of college students. The study aimed to explore the relationship between risk perception, perceived stress, perceived control, and mental health among Chinese college students. This cross-sectional study was conducted among 1,856 college students. The results showed that risk perception was positively correlated with mental health. After adding the mediating variable of perceived stress, risk perception still significantly predicted mental health. In addition, the interaction term of perceived stress and perceived control significantly negatively predicted mental health. Specifically, perceived stress significantly affected mental health in the low-perceived control group. In contrast, in the high-perceived control group, the predictive effect of perceived stress on mental health disappeared. The present study showed that perceived stress partially mediated the relationship between risk perception and mental health;perceived control moderated the relationship between perceived stress and mental health, and high perceived control could buffer the effect of perceived stress on mental health.

The Neutrophil-to-Lymphocyte Ratio is Associated with the Requirement and the Duration of Invasive Mechanical Ventilation in Acute Respiratory Distress Syndrome Patients: A Retrospective Study.

Background: Acute respiratory distress syndrome (ARDS) is associated with high in-hospital mortality and most ARDS patients require ventilatory support. Applying appropriate ventilation strategies based on patients' individual situations has a direct impact upon patients' outcome. The neutrophil-to-lymphocyte ratio (NLR) has been shown to predict the early requirement of invasive mechanical ventilation (IMV) in patients with coronavirus disease 2019 (COVID-19). Our study aimed to investigate the relationship between baseline NLR and IMV in ARDS. Methods: A retrospective study was performed on patients who were diagnosed with ARDS using the Berlin definition and admitted to the First Affiliated Hospital of Soochow University from 2017 to 2022. Clinical data within 24 h after the ARDS diagnosis were collected from the medical record system. Based on the ventilation strategies during hospitalization, patients were divided into three groups and their clinical characteristics were compared. Furthermore, logistic regression analysis was used to screen the independent risk factors for IMV. STROBE checklist was used for this manuscript. Results: 520 ARDS patients were included and the median NLR value in IMV group was significantly higher than that of other groups (P < 0.001). NLR was significantly associated with the requirement of IMV in ARDS patients (OR, 1.042; 95% CI, 1.025-1.060; P < 0.001), other independent risk factors included PaO2/FiO2, Hb, lactate, and use of vasoactive drugs (all P < 0.05). Moreover, we found that the duration of IMV was longer in patients with high NLR (8[IQR, 3-13], 10[IQR, 6-16], respectively, P=0.025). Conclusions: Our results revealed that high baseline NLR level was significantly correlated with an increased risk of IMV in patients with ARDS. Furthermore, higher NLR was associated with prolonged duration of IMV in patients with ARDS.

Biotransformation and transplacental transfer of the anti-viral remdesivir and predominant metabolite, GS-441524 in pregnant rats.

BACKGROUND: Remdesivir was the first prodrug approved to treat coronavirus disease 2019 (COVID-19) and has the potential to be used during pregnancy. However, it is not known whether remdesivir and its main metabolite, GS-441524 have the potential to cross the blood-placental barrier. We hypothesize that remdesivir and predominant metabolite GS-441524may cross the blood-placental barrier to reach the embryo tissues. METHODS: To test this hypothesis, ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) coupled with multisite microdialysis was used to monitor the levels of remdesivir and the nucleoside analogue GS-441524 in the maternal blood, fetus, placenta, and amniotic fluid of pregnant Sprague-Dawley rats. The transplacental transfer was evaluated using the pharmacokinetic parameters of AUC and mother-to-fetus transfer ratio (AUCfetus/AUCmother). FINDINGS: Our in-vivo results show that remdesivir is rapidly biotransformed into GS-441524 in the maternal blood, which then readily crossed the placenta with a mother-to-fetus transfer ratio of 0.51 ± 0.18. The Cmax and AUClast values of GS-441524 followed the order: maternal blood > amniotic fluid > fetus > placenta in rats. INTERPRETATION: While remdesivir does not directly cross into the fetus, however, its main metabolite, GS-441524 readily crosses the placenta and can reside there for at least 4 hours as shown in the pregnant Sprague-Dawley rat model. These findings suggest that careful consideration should be taken for the use of remdesivir in the treatment of COVID-19 in pregnancy. FUNDING: Ministry of Science and Technology of Taiwan.

Deleterious effects of nervous system in the offspring following maternal SARS-CoV-2 infection during the COVID-19 pandemic.

During the Coronavirus disease 2019 (COVID-19) pandemic, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is universally susceptible to all types of populations. In addition to the elderly and children becoming the groups of great concern, pregnant women carrying new lives need to be even more alert to SARS-CoV-2 infection. Studies have shown that pregnant women infected with SARS-CoV-2 can lead to brain damage and post-birth psychiatric disorders in offspring. It has been widely recognized that SARS-CoV-2 can affect the development of the fetal nervous system directly or indirectly. Pregnant women are recommended to mitigate the effects of COVID-19 on the fetus through vaccination, nutritional supplements, and psychological support. This review summarizes the possible mechanisms of the nervous system effects of SARS-CoV-2 infection on their offspring during the pregnancy and analyzes the available prophylactic and treatment strategies to improve the prognosis of fetal-related neuropsychiatric diseases after birth.

Major Impact of Coping Styles on Anxiety and Depression Symptoms in Healthcare Workers During the Outbreak of COVID-19

Background In the early days of COVID-19 outbreak, the normally orderly health system was severely challenged by large numbers of feverish patients and shortage of healthcare workers. The outbreak played a harmful role in the mental health of these healthcare workers. Objective We aim to assess the prevalence of moderate or severe anxiety and depression symptoms (ADSs) of healthcare workers in different regions during COVID-19 disaster and identify the potential risk factors. Methods We did a cross-sectional study on ADS of healthcare workers in epicenter-Hubei province and regions in lower epidemic-other provinces by questionnaire online. The data of ADS, the demographic characteristics, occupational exposure, physical condition, family situation, and coping styles were collected and analyzed. Results A total of 24.68% of the respondents had experienced moderate or severe ADS. Moderate or severe ADSs were in a higher prevalence in Hubei (32.39%) than other provinces (18.22%). Suspicious symptoms on their own and in family members were independent risk factors of moderate or severe ADS of all health workers. Working on the frontline was the independent risk factor for participants in Hubei province, whereas quarantine was the independent risk factor for those in other provinces. Moreover, among all participants, those with negative coping style were more than four times more likely to have moderate or severe ADS than those with positive coping style. Conclusion Moderate or severe ADSs were in a higher prevalence in healthcare workers of Hubei province during COVID-19 outbreak. The coping style may have major impact on ADS in such situation.

Nervous system involvement after infection with COVID-19 and other coronaviruses.

Viral infections have detrimental impacts on neurological functions, and even to cause severe neurological damage. Very recently, coronaviruses (CoV), especially severe acute respiratory syndrome CoV 2 (SARS-CoV-2), exhibit neurotropic properties and may also cause neurological diseases. It is reported that CoV can be found in the brain or cerebrospinal fluid. The pathobiology of these neuroinvasive viruses is still incompletely known, and it is therefore important to explore the impact of CoV infections on the nervous system. Here, we review the research into neurological complications in CoV infections and the possible mechanisms of damage to the nervous system.

Analysis of the Mediating Effect of Risk Perception on the Relationship Between Time Perception and Mental Health of College Students During the COVID-19 Epidemic.

Background: COVID-19 has had a wide impact on the mental health of college students. This study aims to explore the relationship between time perception, risk perception, and the mental health of college students during COVID-19 through a questionnaire survey. Subjects: One thousand two hundred and eighteen college students, 449 male and 769 female, who studied online during the COVID-19 epidemic were selected. Methods: Time Perception Scale, Risk Perception Scale, and SCL-90 were used to investigate the relationship using correlation analysis. Results: During the COVID-19 period, mental health problems of college students were widespread, and 65.93% of college students reported moderate to severe mental health problems. The correlation analysis showed that risk perception, time perception, and the mental health of college students were significantly related. Risk perception played a partial mediating role between present enjoyment and mental health, and risk perception played a partial mediating role between future time perception and mental health. Conclusion: In the case of sudden public crises, we should pay close attention to the mental health of college students, adjust their attitude toward the present and the future, and pay attention to their perception of risk so as to improve their mental health level under crisis.